Newcastle disease (ND) is a highly infectious disease of different avian species caused by a virus belonging to the Avula virus genus of the Paramyxoviridae family. Fusion protein of the Newcastle disease virus (NDV) is responsible for penetration of the virus by fusion of the virion with the host cell membrane (Marin et al., 1996). The fusion protein encoded by F gene is synthesized as a F_o precursor, which is activated only after cleavage into F₁ and F₂ subunits by host cell proteases (Negai et al., 1976; Umino et al., 1990). It is reported that the presence of a number of basic amino acids at the cleavage site determines the pathogenicity of ND viruses. The presence of two pairs of basic amino acids at 112, 113 and 115, 116 along with phenylalanine at 117, makes the fusion protein of velogenic viruses more susceptible to cleavage by ubiquitous proteases of host system. In contrast, the presence of single basic amino acids at 113 and 116 along with leucine at 117 allows the fusion protein of a virulent ND viruses to be cleaved only by trypsin-like proteases present mainly in respiratory and digestive tracts (Collins et al., 1996, Nanthakumar et al., 2000). In this paper, we describe the characterization of Indian isolates of ND viruses obtained from pigeon, guinea fowl and quail by sequence analysis of part of the fusion protein gene encoding the cleavage site.

The viruses (details presented in Table 1) used in this study were maintained in the Division of Avian Diseases, Indian Veterinary Research Institute, Izatnagar, Bareilly (UP) and propagated in 11-day-old embryonated eggs.

Total RNA was extracted from 500 µl of infected allantoic fluid using Trizol reagent (Invitrogen, USA). Equal volume of Trizol was mixed with allantoic fluid, mixed well by vortexing and kept at room temperature for 10 minutes. The tube was centrifuged at 14000g for 15 minutes and the aqueous phase was collected in a fresh centrifuge Cube, and RNA was precipitated by adding equal volume of Isopropanol and centrifugation at 14000g for 20 minutes. Finally, the RNA pellet was washed with 70% ethanol, air dried, and dissolved in 20 µl of distilled water.

The cDNA synthesis and polymerase chain reactions (PCR) were carried out as described by Nanthakumar et al. (2000) with some modifications. The cDNA was synthesized without the addition of di-thiothreitol. One set of primers (forward: 5′-GCAGCTGCAGGGATTGTGGTG-3′, reverse: 5′– TCTTTGAGCAGGAGGATGTTG–3′) was used for the PCR amplification and nucleotide sequencing. The PCR amplification was carried out in thermal cycler (PTC 200, MJ Research, USA), by initial denaturation at 94°C for 2.5 min, followed by 35 cycles of 94, 54 and 72°C each for 45 seconds. The amplified product was analyzed in 2% agarose gel and purified through Wizard PCR purification columns (Promega, USA).

Purified amplicons of all the isolates were subjected to cycle sequencing using the ‘fmol’ DNA sequencing system (Promega) and ³⁵S dATP following the direct incorporation method as described by the manufacturer. The same primers and conditions used for PCR amplification were used for cycle sequencing. After running the samples on a polyacrylamide sequencing gel (Model 52, Life Technologies Inc., USA), nucleotide sequences were read manually. The nucleotide sequences of the known chicken reference strain Texas was used for the comparison. All the nucleotide and deduced amino acid sequences were aligned separately using the Clustal method in the MegAlign Programme of the Lasergene Software (DNASTAR Inc., USA).

Nucleotide sequences of all the viruses from position 197 to 497 (Toyoda et al., 1987) and deduced amino acid sequences from position 51 to 150 were analyzed in the present study. The amino acid alignment is shown in Figure 1. Maximum variation of 11.4% between the Pigeon isolate-55 and Quail isolate-388 was observed at nucleotide level. At amino acid level, maximum variation of 5.2% was noticed among the Quail isolate-388 and other two pigeon isolates (55 and PRD). In general, the pigeon isolates were found different from guinea fowl and quail isolates at the nucleotide and amino acid level. The phylogenetic analysis of nucleotides of all the isolates revealed that Chicken, Pigeon, Guinea fowl and Quail isolates had separate unique lineage since they formed different group. The pigeon isolates were found completely different from the Chicken, Quail and Guinea fowl counterparts in the evolution. Similar findings were observed in phylogenetic analysis of the isolates using amino acid sequence (Fig. 2). The Guinea fowl isolates (18 and 33) along with Quail isolate-388 formed a separate group based on the amino acid. At the cleavage site (F₁–F₂), the pigeon isolates had amino acid sequence of RRQKRF whereas the Quail and Guinea fowl isolates had RRQRRF amino acid sequence indicated that all the isolates were velogenic in nature. The amino acid position at 115 was found different among the pigeon and Guinea fowl or Quail isolates. Many substituted nucleotides were found to be common among chicken, quail and Guinea fowl isolates whereas different in pigeon isolates.

Cleavage site of fusion gene is focused to study the virulence of Newcastle disease virus and grouping into different pathotypes–velogenic, lentogenic and mesogenic. The amino acid change at 124 G to S in the N terminal region of F₁ protein and two pairs of basic amino acids at the cleavage site of the fusion protein, reported in reference velogenic strains (Toyoda et al., 1987; Seal et al., 1995; Collins et al., 1996; Nanthakumar et al., 2000). In the present study, sequence analysis of the cleavage site of various NDV isolates obtained from Guinea fowl (2), pigeon (2) and quail (1) revealed that all had two pairs of basic amino acids of velogenic pathotype (RRQK/RRF) at the cleavage site. Pigeon isolates were not in consistence with the earlier report regarding the amino acid G to S at position 124. They had two pairs of basic amino acid at their cleavage site and had G at position 124.

Though all the isolates were found to be velogenic based on the cleavage site amino acid, the Guinea fowl and Quail isolates had basic amino acid R at position 115 and pigeon isolates had basic amino acid K at the same position. Meulemans et al. (2002) have reported that the F₁/F₂ cleavage site has changed from GRQKRF to RRQKRF during the course of evolution. The overall results indicated that the Guinea fowl and quail isolates were closely related where as the pigeon isolates were observed to have more evolutionary difference from other counterparts. There is possibility of exchange of ND viruses among Chicken, Guinea fowl and Quails, since they are always reared on close proximity in commercial farms. However, the pigeons were mostly in free range. Unless and otherwise, the pigeons disseminate the virus into these commercial farms indirectly, there is no direct contract. Similar situation to disseminate the pigeon NDV into commercial farms is very low. Some inconsistency in pathotyping the NDV using cleavage site amino acid sequence and other pathogenicity tests viz., mean death time (MDT), intracerebral pathogenicity index (ICPI) and intravenous pathogenicity index (IVPI) have been reported (Stram et al., 1998, Nanthakumar et al., 2000). Meulemans et al. (2002) have indicated that ICPI of Pigeon isolates having RRQKRF motif was highly variable but largely lower (mean, 0.69) than that reported for viruses isolated in the year 1983 and 1984 (mean, 1.44). They have also suggested that presence of multiple basic amino acids at C-terminus of the F₂ protein (atleast three arginine or lysine residues between residues 113 and 116) and phenylalanine at residue 117, which is N-terminus of the F₁ protein should be preferred to ICPI test, and should be recommended for the assessment of the virulence potential of NDV isolates from non-poultry host. Sequence analysis of the more number of NDV isolates from different avian species would provide valuable information on the molecular epidemiology, evolution, and pathotype prevalence of this economically important virus.

References