Mycobacterial diseases have always been difficult to study and this has been particularly evident in diagnosis and epidemiological investigations of tuberculosis. The definitive diagnosis of tuberculosis rely on isolation and identification of the organism, but the usefulness of these methods is very limited due to cumbersome and time-consuming procedures. Attempts to improve the speed of mycobacterial detection using radiometric and RNA detection methods have met with only a partial success. The need for the development of a sensitive, specific and rapid test for the laboratory diagnosis of tuberculosis has long been acknowledged. The polymerase chain reaction (PCR) technique would meet the requirements for such a test. In recent years, molecular biology has provided new approaches, which have enabled detailed studies regarding molecular characteristics of mycobacteria. |
Many workers have developed PCR-based detection systems targeting part or whole of IS6110 element (Kox et al., 1994; Vitale et al., 1998). This amplified PCR product was further used for the preparation of a probe either by radioactive labelling or non-radioactive labelling like digoxigenin (DIG) labeling system. Probes have been used both for detection of mycobacteria in clinical samples and also in restriction fragment length polymorphism (RFLP) studies of M. tuberculosis complex strains (Kolk et al., 1992; Collins et al., 1994). |
In the present study, DNA elements that are specific to M. tuberculosis complex organisms have been investigated for their potential use in diagnostic assays based on the PCR and DNA probe techniques. |
Top Material and methods Cultures Standard cultures of M. bovis AN5 and M. paratuberculosis were procured from Indian Veterinary Research Institute, Izatnagar, UP. Standard cultures of M. tuberculosis H37RV, M. bovis BCG and M. avium and two human isolates of mycobacteria were procured from National Tuberculosis Institute, Bangalore. Two bovine isolates of M. tuberculosis and one isolate of M. phlei available in the Department of Veterinary Microbiology, Hebbal, Bangalore and four M. bovis isolates obtained from lymph node biopsy samples collected from single intradermal tuberculin test positive cattle were used in the present study. Clinical samples Clinical samples were collected from two different farms. Farm A was an organized dairy herd consisting of about 2000 cows and Farm B was a small bull farm. The particulars of samples collected are shown in Table 1.
Extraction of DNA from liquid cultures The chromosomal DNA of the mycobacteria grown in liquid medium was extracted as described by Skuce et al. (1994). The broth culture in Middlebrook 7H9 media was heat inactivated at 80°C for 15 min and centrifuged at 5000 xg for 10 min. The pellet was resuspended in 500 µl of TE buffer. Fifty microliters of lysozyme (10 mg/ml) was added prior to incubation at 37°C for one hour and treated with 75 µl of 10 per cent (wt./vol) sodium dodecyl sulfate (SDS) and 6 µl of proteinase K (10 mg/ml) and incubated for 10 min at 65°C. Subsequent to this digestion, 100 µl of 5 M NaCl was added, followed by 100 µl of N-cetyl-NNN trimethyl ammonium bromide (10 per cent wt./vol) and 4.1 per cent NaCl solution. The mixture was vortexed until it was milky in appearance, it was incubated at 65°C for 10 min. The DNA in the mixture was extracted with equal volume of phenol saturated with TE buffer (10 mM Tris HCl, pH 8 and 1 mM EDTA pH 8) in 1.5 ml micro-centrifuge tubes. The resulting aqueous phase containing DNA was collected, extracted with equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) mixture. The aqueous phase was collected and DNA precipitated by adding 0.6 volume of isopropanol in the presence of 0.2 M NaCl at −20°C overnight. The DNA was collected by centrifugation at 10,000 xg for 10 min at 4°C. The DNA pellet was rinsed in 70 per cent (vol./vol.) ethanol, air-dried and resuspended in 100 µl of TE buffer and stored at −20°C until used. Extraction of DNA from blood sample Frozen blood samples were kept in a water bath at room temperature for thawing. Blood was transferred into a centrifuge tube and diluted with equal volume of PBS, centrifuged at 3500 xg for 15 min at room temperature and the supernatant was discarded. The pellet was suspended in TE buffer and extraction of DNA was carried out using the same protocol as that of liquid cultures. Extraction of DNA from milk samples Frozen milk samples were kept in a water bath at room temperature. About 20 ml of milk was centrifuged at 3500 rpm for 30 min. The supernatant was discarded after retaining the cream, which was then mixed thoroughly with sediment. The suspension was then diluted with 20 ml of sterile normal saline and centrifuged at 3500 rpm for 30 min. The clear supernatant was discarded and the sediment was washed again with 20 ml of sterile normal saline and centrifuged as above. The pellet was suspended in TE buffer and then DNA extraction was carried out as for the liquid cultures. Extraction of DNA from nasal swabs Nasal swabs were soaked in 20 ml of sterile PBS solution for 30 min at room temperature with occasional shaking. The suspension was centrifuged at 3500 rpm for 15 min. The clear supernatant was discarded. The sediment was washed again with 20 ml of sterile PBS and recentrifuged as above. The supernatant was discarded and the pellet was suspended in TE buffer before proceeding further for DNA extraction as for liquid cultures. Extraction of DNA from semen Semen doses from suspected bulls (0.8 ml) were pelleted at low speed and the supernatant was collected in a separate eppendorf tube. It was further centrifuged at 15000 rpm for 5 min and the fine pellet in the tube was stored in TE buffer for template DNA extraction. Polymerase chain reaction (PCR) Designing of primers for PCR Primers for the PCR were designed from an insertion sequence, IS 6110 that was first isolated from mycobacterium tuberculosis cosmid library as a repetitive sequence (Thierry et al., 1990). This insertion sequence was found to be specific to mycobacteria belonging to the M. tuberculosis complex. The primer sequences were selected to amplify the whole 1360 base pairs of IS 6110 element. The following are the sequences of the primers designed: MTbL1 (29 mer): 5′GGATGCATGAACCGCCCCGGCATGTCCGG3′ MTbR2 (22 mer): 5′TGAACCGCCCCGGTGAGTCCGG3′ The forward or 5′ end primer corresponds to position 3 to 25 nucleotides and the first six bases corresponds to the Xho I restriction site. The reverse or 3′ end primer corresponds to position 1336 to 1357 nucleotides of IS 6110 element. Pcr amplification PCR amplification of 1360 base pair product was carried out according to the standard protocol described by Sambrook et al. (1989) with necessary modifications. A typical 50 ml reaction had 1x PCR buffer (25 mM Tris-HCl pH 8.3, 2.5mM MgCl2, 50 mM KCl, 0.01% gelatin), 100 mM each of four dNTPS, 20 pmol each of upstream and downstream primers. To this reaction mixture 100 ng of mycobacterial genomic DNA was added after initial denaturation at 95°C for five min followed by snap cooling. Taq DNA polymerase (1.25U) was added when the reaction mixture reaches 60°C in the thermal cycler to prevent non specific binding of the primers and to hot start the PCR reaction. The tubes were then subjected to 35 temperature cycles, which consisted of denaturation at 94°C for one min, annealing at 55°C for one min and extension at 72°C for 1½ min. Final extension time of 10 min at 72°C was set for the final cycle to ensure uniform full-length product. The PCR amplified product was analysed by electrophoresis in one per cent agarose gels and visualized by ethidium bromide staining. Appropriate positive and negative controls were included in the PCR. Preparation of DNA probe Digoxigenin (DIG) labelling of DNA by random priming The PCR amplified DNA was eluted from the LMP agarose gels, purified and labelled with digoxigenin using DIG DNA labelling and detection kit of Boehringer Mannheim (Germany). The labelled DNA was used as a probe for detection of mycobacterial DNA. The protocols described in the DIG system user's guide for membrane hybridization (Boehringer Mannheim) was followed for labelling. Dot blotting and hybridization of DNA Mycobacterial DNA extracted from clinical samples, or DNA extracted from cultures was blotted on to the nylon membrane to check the presence of mycobacterial DNA. The DNA samples to be blotted were diluted in sterile distilled water to obtain a concentration of 40 ng/50 ml. From this two-fold dilutions of DNA were prepared in TE buffer to get 40, 20, 10, 5 ng per 50 ml dilutions and denatured by keeping in boiling water bath for five min. Samples were incubated at room temperature for 10 min after adding NaOH (10 M stock) solution to 0.5 M concentration and then neutralized with equal volume of 2M ammonium acetate. The membrane was soaked in boiling distilled water and then in 20x SSC solution before placing it in S & S manifold dot blot apparatus over a three mm Whatman filter paper presoaked in 20x SSC. The membrane was kept under vacuum to dry for five min after the liquid had passed through. The membrane was put in 0.4 M NaOH for 10 min, washed in 2x SSC and air-dried before allowing it for cross-linking in UV-transilluminator for five min. The nylon membranes blotted with DNA were kept in sealed plastic bags containing 20 ml of pre-hybridization buffer [1x conc–5x SSC, deionized formamide 50%, N-lauryl sarcosine 0.1% (w/v), SDS 0.02% (w/v) and blocking reagent 2%]. Approximately 0.2 ml of prehybridization solution was used for each square centimeter of nylon membrane. The sealed plastic bag was incubated at 42°C overnight. The membrane was washed twice in 2xSSC solution and then used for hybridization. Freshly denatured probe was added to the pre-hybridization solution and the membrane was incubated in it for 48 h at 42°C with gentle shaking. Membranes were washed twice with wash buffer consisting of 2x SSC and 0.1 % (w/v) SDS for five min each at room temperature followed by two washings in 0.1x SSC and 0.1 % SDS (w/v) solution at 68°C for 15 min. Top Results Amplification of purified mycobacterial DNA Amplification of IS 6110 element with different mycobacterial DNAs was standardized. The optimum concentration of MgCl2 was found to be 2.5mM, which showed clear PCR band. Concentrations less than 1.5 mM and more than 3.5 mM did not yield amplification. The optimum concentration of target DNA was found to be 100 ng. Below this concentration the PCR showed a feeble amplification product. When different concentrations of primer were tested 20 pmoles of each of the forward and reverse primers were found to be optimum. An initial denaturation temperature of 95°C for five min was found to be essential for the amplification reaction to take place. The DNA denaturation temperature of 94°C for one min was optimum. When different primer annealing temperatures were tested, 55°C showed clear PCR band without any non-specific amplification products. The primer extension temperature of 72°C for 1½ min was found to be optimum. When different mycobaterial DNAs were used as targets for amplification reaction in PCR, the specific 1360 bp amplification product was observed only in pathogenic mycobacteria belonging to M. tuberculosis complex viz., all the isolates of M. bovis and M. tuberculosis. M. bovis AN5, M. tuberculosis H37RV and M. bovis BCG. Whereas amplification product was not observed with DNAs of M. phlei, M. avium and M. paratuberculosis,which were included in the test as negative controls. Preparation of DNA probe by digoxigenin labelling The purified PCR product of mycobacterial DNA labelled with digoxigenin showed optimum reaction at 1 in 500 dilution. This dilution was used further in hybridization studies. Dot blot hybridization Different concentrations of mycobacterial DNAs dot blotted onto the nylon membrane after probing with dig labeled probe showed positive hybridization signals with DNAs of M.tuberculosis complex group of organisms. Decreasing intensity of hybridization signal was observed with decreasing dilution of DNA. The minimum quantity of DNA required to show positive signal was 5 ng. Dot blot hybridization:Screening of field samples by PCR and dot blot hybridization Farm A Twenty samples each of blood, nasal swabs and milk were collected from tuberculin test positive animals and one sample each of blood, nasal swab and milk was collected from tuberculin test negative animal from farm A. The results of polymerase chain reaction of the total sixty three samples collected are depicted in the Table 2. Twelve (60 per cent), three (15 per cent) and eight (40 per cent) of the blood, milk samples and nasal swabs, respectively, were positive by PCR (Fig. 1). Thirteen (65 per cent), three (15 per cent) and eight (40 per cent) of the blood, milk samples and nasal swabs, respectively, were positive by dot blot hybridization (Fig. 2). All the samples detected positive by agarose gel electrophoresis of PCR product were also found positive by dot blot assay using PCR product. One sample that was not detected by agarose gel electrophoresis of PCR product was found to be positive by dot blot hybridization.
Out of twenty animals from which samples were collected, three cows revealed presence of mycobacterial DNA in all the blood, nasal swab and milk samples collected. Five cows showed positive reaction inblood sample and nasal swab, whereas five cows showed presence of mycobacterial DNA in the blood sample only. The samples collected fromtuberculin test negative animals were also found to be negative inpolymerase chain reaction and dot blot assay. Farm B Four each of blood, nasal swabs and semen samples were collected from tuberculin test positive bulls from farm B. Ten each of blood, nasal swabs and semen samples were collected from tuberculin test negative bulls. The results of PCR and dot blot assay of the forty-two different samples collected from farm B are depicted in Table 3. Out of four tuberculin test positive animals three showed presence of mycobacterial DNA in both blood and nasal swabs (75 per cent) but none of the semen samples were positive by both the tests. The blood, nasal swabs and semen samples collected from all the ten tuberculin negative bulls were also negative in PCR and dot blot assay.
Top Discussion Mycobacterial DNA has recently been sequenced and the sequences that are specific to M. tuberculosis complex have also been identified. One such unique sequence of 1360 bp IS 6110 element sequenced by Thierry et al. (1990) has drawn the attention of several workers because of its specificity to M. tuberculosis complex organisms, which has been further confirmed by several workers (Eisenach et al., 1990; Collins et al., 1993; Kox et al., 1994). |
In the present study, PCR was standardized using the purified DNA from the standard strains of mycobacteria including M. bovis AN5, M. bovis BCG and M. tuberculosis H37Rv. A 1360 bp amplification product was consistently obtained with the DNAs of all these organisms. But DNA from M. phlei, M. avium and M. paratuberculosis standard cultures did not yield any amplification product. These findings are in consensus with the findings of Hellyer et al. (1996) who also used amplification of the IS 6110 element in the detection of M. tuberculosis complex organisms. The cycling conditions standardized for PCR in the present study yielded maximum amplification product confirming the suitability of the assay conditions. |
As conventional diagnostic procedures for mycobacterial detection are time consuming and lack the required sensitivity and specificity, PCR is considered as a suitable alternative method of choice for diagnosis of tuberculosis. Several workers have standardized this technique for the diagnosis of tuberculosis particularly for the detection of the DNA of M. tuberculosis complex group of organisms only (Kolk et al., 1992; Collins et al., 1994; Kox et al., 1994; Vitale et al., 1998). The false positive reactions in the tuberculin test are due to the sensitisation of the animals with related bacterial genera such as nocardia, corynebacteria and other mycobacteria including M. paratuberculosis, M. avium and M. phlei that are frequently encountered in the diagnosis of bovine tuberculosis (Grange, 1979). PCR could eliminate these false positive reactions. |
Among hundreds of M. tuberculosis complex isolates that have been investigated, none was found to be devoid of this IS element (Hermans et al., 1990). Hence, occurence of false negative reactions in PCR is a remote possibility as it can detect the nanogram level of DNA in the clinical samples. |
While implementing eradication programs accuracy and ease of performance of the test is important with high specificity so that negative animals are not slaughtered. In such situations, PCR could be ideal choice over the conventional techniques for diagnosis of tuberculosis in live animals. |
Among the tuberculin test positive animals sixty to seventy five per cent of the blood samples were positive by PCR also, whereas sixty five to seventy five per cent were dot blot assay positive which is in general agreement with the findings of Barry et al. (1993) and Ahmed et al. (1998). These observations indicate that a DNA probe and PCR based assays are feasible for the direct detection of M. bovis DNA in the blood of infected cattle. Moreover, even partially degraded DNA from lysed organisms would give a positive result thereby these tests proved to be superior over isolation of organisms which requires the presence of viable organisms in sufficient number in the samples which is usually possible only in advanced stages of the disease. The tuberculin test positive but PCR negative animals may account for false positive results usually encountered in routine tuberculin testing or other possibilities could be that the animal might have overcome the bacteraemia or have localized sequestered lesions in other organs. |
The positive reaction with nasal swabs range from 40 to 75 per cent in two farms both by PCR and dot blot assay. The positive reaction with these samples may be influenced by the incidence of open type of pulmonary tuberculosis as stated by Vitale et al. (1998), who detected 58 per cent of the open cases of pulmonary tuberculosis by PCR. They stated that PCR with nasal swabs show high specificity and could be used together with other samples from the same subjects. Taking nasal swab is easier and quicker than other more invasive sampling methods and is useful in pulmonary tuberculosis, which is a very common form of infection in animals. |
Fifteen per cent of the milk samples of tuberculin test positive cows were also positive in both PCR and dot blot assays which appears to be less sensitive compared to blood and nasal swabs. This low level of positivity in the milk samples may be due to intermittent and irregular excretion of organisms in the milk. However, with all these limitations, the importance of the milk sample lies with the fact that it is possible to detect the animals that are excreting the mycobacteria in the milk constituting a serious public health problem. |
None of the semen samples collected from tuberculin test positive bulls in the present study were positive in PCR and dot blot hybridization. Where as Ahmed et al. (1998) detected one positive sample out of the three semen samples collected from tuberculin test positive bulls by PCR. However, failure to demonstrate the DNA in the semen could be due to the fact that very small numbers of tuberculin test positive animals were used in the present study. All the samples collected from tuberculin test negative animals were also negative by both PCR and dot blot assay. |
However, a large number of samples should be screened from different farms at regular intervals and further improvement in sampling techniques should be made before it can be used widely in the field conditions as a routine test for screening cattle. |
Top Figures | Fig. 1: Screening of field samples by polymerase chain reaction.
|  | |
| | Fig. 2: Screening of field samples by dot blot hybridisation assay.
|  | |
|
Tables | Table 1: Details of the clinical samples collected
| | Sample | Number of samples collected |
| | Farm A | Farm B |
|
| | SID test positive | SID test negative | SID testpositive | SID test negative |
| | Blood | 20 | 1 | 4 | 10 | | Nasal swabs | 20 | 1 | 4 | 10 | | Milk | 20 | 1 | ‐ | ‐ | | Semen | ‐ | ‐ | 4 | 10 |
| | | Table 2: The details of SID test, PCR and dot blot assay conducted on different clinical samples of Farm A
| | Sample | Number of samples from SID test | Number of samples subjected to PCR | Number of samples subjected to Dot Blot Assay |
|
|
| | Positive animals | Negative animals | SID (+) PCR (+) | SID (+) PCR (−) | SID (−) PCR (−) | SID (+) Dot blot (+) | SID (+) Dot blot (−) | SID (−) Dot blot (−) |
| | Blood | 20 | 1 | 12(60%) | 8(40%) | 1(100%) | 13(65%) | 7(35%) | 1(100%) | | Nasal swabs | 20 | 1 | 8(40%) | 12(60%) | 1(100%) | 8(40%) | 12(60%) | 1(100%) | | Milk samples | 20 | 1 | 3(15%) | 17(85%) | 1(100%) | 3(15%) | 17(85%) | 1(100%) |
| | | Table 3: The details of SID test, PCR and dot blot assay conducted on different clinical samples of Farm B
| | Sample | Number of samples from SID test | Number of samples subjected to PCR/Dot Blot Assay |
|
|
| | Positive animals | Negative animals | SID (+) PCR (+) Dot blot (+) | SID (+) PCR (−) Dot blot (−) | SID (−) PCR (−) Dot blot (−) |
| | Blood | 4 | 10 | 3(75%) | 1(25%) | 10(100%) | | Nasal swabs | 4 | 10 | 3(75%) | 1(25%) | 10(100%) | | Milk samples | 4 | 10 | 0(0%) | 4(100%) | 10(100%) |
| |
|
Acknowledgements This work was supported by grants from Council for Scientific and Industrial Research in the form of Senior Research Fellowship to the first author during the period of study. We gratefully acknowledge the help rendered from National Tuberculosis Institute, Bangalore in providing the standard cultures. Top References | | AhmedN., GroverS., BatishV.K.
(1998)
Second Pan Common Wealth Veterinary Conference.
848 TopBack | | BarryT., GlennonT., SmithT., GannonF.
(1993)
Vet. Rec.
132:
66 TopBack | | CollinsD.M., ErasmusonG.F., StephensS.K., YatesD.M., DeLisleG.W.
(1993).
J.Clin.Microbiol.
31:
1143 TopBack | | CollinsD.M., DeLisleJ.D., CollinsG.W., CostelloE.
(1994).
Vet. Rec134:
681. TopBack | | EisenachK.C., CaveJ.H., BatesM.D., CrawfordJ.T.
(1990).
J.Infect Dis.,
161:
977. TopBack | | GrangeK.M.
(1979)
Mycobacterial diseases.
ArnoldLondon111 TopBack | | HellyerT.J., DesjardinL.E., AssafM.K., BatesJ.H., CaveM.D., EisenachK.D.
(1996).
J Clin Microbiol.
34:
2843. TopBack | | HermansP.W.M., SchuitemaA.R.J., SoolingenD.V., VerstynenC.P.H.J., BikE.M., TholeJ.E.R., KolkA.H.J., EmbdenJ.D.A.
(1990).
J Clin Microbiol.
28:
1204. TopBack | | EmbdenJ.D.A., KolkA.H.J., SchuitemaA.R.J., KuijperS., LeeuwenJ.V., HermansP.W.H., HartskeerlR.A.
(1992).
J Clin Microbiol30:
2567. TopBack | | KoxL.F., RhienthongD., MirandaA.H., UdomsantisukN., EllisK., LeeuwenJ.V., HeusdenV., KuijperS., KolkA.H.J.
(1994).
J Clin Microbiol32:
672. TopBack | | SambrookJ., FritschE.F., ManiatisT.
(1989).
Molecular cloning : a laboratory manual, (2nd ed.
Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y). TopBack | | SkuceR.A., BritianD., HughesM.S., BeckL.A., NeillS.D.
(1994).
J Clin Microbiol32:
2387. TopBack | | ThierryD., CaveM.D., EisenachK.D., CrawfordJ.T., GicquelB., GuesdonJ.L.
(1990).
Nucleic Acids Res18:
188. TopBack | | VitaleF., CapraG., MaxiaL., RealeS., VescoG., CaracappaS.
(1998)
J Clin Microbiol36:
1050. TopBack |
|