Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases
Year : 2003, Volume : 24, Issue : 2
First page : ( 143) Last page : ( 147)
Print ISSN : 0970-9320.

Purification of infectious bronchitis virus propagated in embryonated chicken eggs and its confirmation by RT-PCR

Sylvester S. Arthur, Kataria J.M.*, Dhama K., Rahul S., Bhardwaj Nitin, Tomar S.

Division of Avian Diseases, Indian Veterinary Research Institute, Izatnagar - 243 122 (U.P.)

*Corresponding author

Received:  6  July,  2004.

Abstract

The Massachusetts strain (M41) of avian infectious bronchitis virus (IBV), was obtained in freeze dried ampoule and reconstituted in 1 ml phosphate buffered saline (PBS) (pH 7.4), of which 0.2 ml was inoculated in ten 9 day old specific pathogen free (SPF) embryonated chicken eggs (ECE). At 48 hours of incubation, the embryos were chilled and the allantoic fluid harvested with titre of the virus determined to be 103.108 EID50/0.1 ml, 103.508 EID50/0.1 ml, and between 104.508-5.508 EID50/0.1 ml of allantoic fluid after 1st, 2nd and 3rd passages, respectively. Characteristic signs of IBV like curling and dwarfing of the embryos were obtained at 7 days post infection. The virus growth was also confirmed by in vitro specific amplification of RNA from the infected allantoic fluid using reverse transcription - polymerase chain reaction (RT-PCR). The high titred virus at the third passage level was used as a seed inoculum for bulk virus propagation in fifty 9 day old ECE, following the protocol described earlier. Along with the allantoic fluid, the chorioallantoic membrane (CAM) was also carefully collected separately from each inoculated embryo and washed once with PBS, and centrifuged to remove RBCs. The pooled CAMs were homogenized thoroughly and the homogenate clarified by centrifugation at 1500 rpm for 10 minutes. For purification of the virus, 20 ml of the allantoic fluid and CAM suspension were layered separately over 5 ml of discontinuous 30% and 55% sucrose in GNTE buffer (0.025M Tris HCl, 0.2M Glycine, 0.002M EDTA; pH 7.0) and centrifuged at 90,000 g for 4 hrs at 4°C. The virus specific band was collected from the interface of sucrose gradient and diluted 1:2 in GNTE buffer. Further, the above suspension was layered over 15 ml of continuous gradient of 30% and 50% sucrose and centrifuged at 90,000 g for 6 hrs. The virus band was collected, diluted as described before and pelleted at 90,000 g for 3 hrs through a 5 ml of 30% sucrose cushion. The virus pellet was resuspended in GNTE buffer and the protein concentration estimated at 260/280 nm optical density (OD) ratio and the virus preparation having an OD of 1.2 was considered as pure in nature. IBV purified by density gradient ultra-centrifugation from allantoic fluid had a protein concentration of 2.56 mg/ml and the CAM virus had 4.36 mg/ml. Higher yield of the virus was obtained from the CAM membranes than from the allantoic fluid. The presence of the virus was confirmed using RT-PCR testing of the purified virus suspension. Further work on the use of the purified IB virus as an antigen in ELISA is underway.

Top

Top

Materials and Methods

Virus

The vaccine virus Massachusetts strain (M41) was obtained in freeze dried ampoule (passage level not known) and the ampoule was dissolved in 1 ml PBS (pH 7.4). 0.2 ml of the inoculum was inoculated in five 9 day old SPF (Specific pathogen free) chicken eggs (VHL Pune) and the eggs candled daily for 48 hrs. Those, which died within 24 hrs, were discarded as non-specific death and those, which survived, were chilled and the allantoic fluid was collected, centrifuged at 3000 rpm for 10 min at room temperature and stored at -20°C till use. The procedure was repeated twice till the characteristic signs of IBV like curling and dwarfing of the embryos were obtained (Fig. 1). The virus growth was confirmed by in vitro amplification of the extracted RNA from the 3rd passage infected allantoic fluid using RT-PCR.

Titration of virus

Virus titration was carried out in embryonated chicken eggs following the procedure of Verma et al. (1964). Serial ten-fold dilution of the virus material was inoculated in 0.1 ml amounts into each of the 3 ECE per dilutions ranging from 10-2 to 10-8. Infection of virus was presumed from the occurrence of dwarfing and curling among the embryos. Embryo deaths within 24 hours post-inoculation were regarded as due to nonspecific cause and discounted while calculating the end point titres. Three passages were done and titration was done after each passage in ECE. Endpoint titres expressed as 50% embryo infective doses (EID50) per ml was calculated by the method of Reed and Muench (1938).

Bulk production of virus stock from Embryonated chicken eggs

For the bulk production of virus stock fifty 7 day old ECE were obtained from Experimental Hatchery Unit of the Central Avian Research Institute, Izatnagar. The 9-day-old embryos each were inoculated with 0.1 ml of virus inoculum M41 (Massachusetts strain) containing 104.508 EID50/0.1 ml and candled daily for 48 hrs. As mentioned earlier those, which died in 24 hrs, were discarded as non-specific death and those, which survived, were chilled and the allantoic fluid was collected, centrifuged at 7000 rpm for 30 min at 4°C and stored at -20°C till use. The presence of the virus was confirmed by RT-PCR.

From Chorio allantoic membrane (CAM)

The Chorio allantoic membrane was also collected carefully from each inoculated embryo and washed once with PBS by centrifugation at 3000 rpm for 10 minutes to remove the RBCs. The pooled CAMs were homogenized thoroughly using a homogenizer (Dupont instruments). The homogenate was centrifuged once at 1500 X for 10 minutes to remove the coarse particles. The supernatant collected was used for virus purification stored at -20°C till further use. The presence of the virus was confirmed by RT-PCR.

Purification of the virus

The virus purification was performed as per Marquardt et al.(1981) employing sucrose density gradient ultra centrifugation. Briefly, 20 ml of allantoic fluid/CAM suspension was layered over 5 ml of discontinuous 30% and 55% sucrose in GNTE buffer pH 7.0 (0.025M Tris HCl, 0.2M Glycine, 0.002M EDTA) and centrifuged at 90,000 x g for 4 hrs at 4°C. The virus band was harvested from the interface of 30% and 55% sucrose gradient and diluted 1:2 in GNTE buffer. The above suspension was further layered over 15 ml of continuous sucrose gradient of 30% and 50% sucrose and centrifuged at 90,000 X g for 6 hours. The virus band was collected and diluted as described earlier. The virus was finally pelleted at 90 000 X g for 3 hrs through a 5ml 30% sucrose cushion. The virus pellet was resuspended in GNTE buffer and the protein concentration was estimated using UV spectroscopy.

Estimation of protein concentration

Optical density of the purified virus was taken at 260 nm and 280 nm in the spectrophotometer. The protein content in the sample was determined using the formula: Protein (mg/ml) = (OD260 x 1.55)- (OD280 x 0.77). Ratio of absorbance at 260/280nm was calculated to check the purity of the virus sample. The virus preparation having an OD value of 1.2 was considered as pure.

Confirmation by RT-PCR

For the detection of virus by RT-PCR, total RNA from the infected allantoic fluid was extracted by Trizol reagent (Life-Technologies Inc. USA), as per the manufacturer’s protocol. In brief, 250 µl of allantoic fluid suspension was taken, adding 750 µl of TRIzol. Sample was incubated at room temperature for complete cell lysis and then mixed with 200 ml of chloroform. After incubation at room temperature for 5 min, the mixture was centrifuged at 12000 x g for 10 min and the aqueous phase was collected. The RNA in aqueous phase was precipitated by adding 0.5 ml of isopropanol and was resuspended in 20 µl of nuclease free water after washing with 70% ethanol.

Reverse transcription was carried out using 8 µl of total RNA extracted, following the protocol as has been standardized in our laboratory. In a 20 µl reaction volume, cDNA was synthesized using 50 ng random hexamer primers and 200 U of MMLV reverse transcriptase (Promega) at 37°C for 1 hour. For Polymerase Chain Reaction (PCR), 5 µl of cDNA was subjected to amplification using 10 picomoles of each IBV S1 gene specific primers described earlier, 200 mM of dNTPs mix, 3 U of Taq DNA polymerase and 0.9 mM Mg++ in 1x PCR buffer (all Promega). The PCR conditions used were initial denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C, primer annealing at 43°C and extension at 72°C of 1.5 min each. Primers used to amplify the S1 gene includes forward 5’TGAAAACTGAACAAAAGACA3’ nucleotide position 20302-20321 and reverse primer 5’ CATAACTAACATAA GGGCAA3’ nucleotide position 22002-22021, designed from Massachusetts M41 serotype to amplify the S1 whole gene (Kwon et al., 1993). The generated PCR product was analysed in 1.5% agarose gel, demonstrating a band of 1.7 Kbp. Authenticity of the primary PCR product was confirmed by Restriction endonuclease digestion (RE) also (Fig. 2).

Top

Results and discussion

Top

Figures

Fig. 1: C - Control uninfected 18 day old chick ? ? ? ? ?I - Chick infected with M41Massachusettes vaccine strain showing characteristic teratogenic changes like curling and dwarfing at 20 day old embryos. TopBack

Fig. 2: Detection of IBV by RT-PCR and RE analysis in infected allantoic Fluid ? ? ? ? ?M-PCR Marker ? ? ? ? ?1 - Pst I Digested Product ? ? ? ? ?2 - M41 Massachusettes Vaccine strain TopBack

Fig. 3: Occurence of Defective Interferring Particles In Allantoic fluid of the infected embryos ? ? ? ? ?M-100 bp DNA ladder ? ? ? ? ?1 - At 96 hr interval ? ? ? ? ?2 - At 72 hr interval ? ? ? ? ?3 - At 48 hr interval TopBack

Acknowledgements

The authors are thankful to Dr.M.P.Yadav, the Director Indian Veterinary Research Institute, Izatnagar, and Head, Avian diseases, IVRI, Izatnagar for providing the necessary facilities to carry out the work.

Top