INTRODUCTION In Bangladesh about 65% rural people depend on agriculture and livestock rearing is a common source of rural income. Frequent outbreak of infectious diseases hamper livestock production and among these, foot-and- mouth disease (FMD) is a leading cause in Bangladesh. FMD is an acute viral disease of cloven-hoofed animals including pigs and more than 70 wildlife species1. This is the most notorious infection among all animal diseases, and there is huge restriction on international trade of animals and animal products (meat, milk, hide and butter) due to its transboundary nature of transmission2. It is estimated that 25% productivity of individual recovered animals are lost due to FMD3. |
The clinical severity of FMD depends on the infecting dose and strain of virus involved. Infection with FMDV causes an acute disease that spreads very rapidly and is characterized by fever, lameness and vesicular lesions on the feet, tongue and teats, with high morbidity but low mortality4. Although FMD rarely causes death in adult animals but mortality rates are higher in young animals. The etiological agent, FMDV is a single stranded RNA virus of the Aphthovirus genus, family Picornaviridae having seven serotypes (O, A, C, Asia-1, SAT1, SAT2, and SAT3) and more than 65 subtypes5. All FMDV serotypes are immunologically different and vaccination with one serotype does not confer solid protection to other serotype or subtypes of a serotype6. |
FMD is transmitted from infected to apparently healthy susceptible animals through air or direct contact7. Infected animals excrete virus shortly before showing the clinical signs and highest excretion occurs after the infection. All secretions of an infected animal such as saliva, milk, nasal fluid and feces have highest amount of virus which can cause disease outbreak8. FMDV also transmits through air; the airborne virus enters in respiratory tract by inhalation. The virus may also enter in to the host body through ingestion and damaged epithelium. In some ruminants virus is not completely cleared from the pharynx even after recovery and the animals act as carriers for FMDV9. |
The disease in Bangladesh is commonly known as ‘Khura Rog’ and is endemic in cattle. The serotypes circulating in Bangladesh were predominantly O FMD virus5,10,11, followed by A and Asia 112. Serotype C is no longer exists in the globe including Bangladesh5,13. Clinical history, postmortem examination and histopathology are the common diagnostic tools for initial detection of FMD in animals. The confirmatory diagnosis can be made by using serology and RT-PCR assayes14,15. In order to undertake effective control and preventive measures against FMD, it is important to know the serotypes and topotypes of FMDV responsible for field outbreaks in a specific geographical area. In this study, an attempt was undertaken for investigation of natural outbreaks of FMD in cattle of several farms at Sirajganj district, Bangladesh. Recent years we witnessed higher rate of mortality of young cattle and variable rate of mortality of adult cattle; the causes of death was investigated by means of necropsy and histopathology. The serotype and topotype of the viruses involved were investigated using RT-PCR and sequencing. The sequence information of VP1, 2A and 2B genes was used to know the mutation profile and phylogenetic position of the organism. |
Top MATERIALS AND METHODS A total of 50 cattle from various small scale dairy farms were investigated in Sirajganj district. Cattle with typical signs of FMD were investigated thoroughly and samples were collected. Young (n=04) and adult (n=05) cattle died due to FMD were necropsied and systemic investigation was carried out. Pieces of tissues from infected and dead animals were used in histopathological examination. Oral/pedal tissues were collected from 10 severely infected cattle for RT-PCR detection of FMD viral serotype. |
Histopathological investigation During necropsy heart, lung, liver, kidney, spleen, lymphnodes, tongue and skin were collected and fixed in 10% buffered neutral formalin. Formalin fixed tissue samples were trimmed, processed, sectioned and stained with H&E16. A low (10×) and high power (40×, 100×) microscopic analysis were carried out to observe changes in the internal organs if any. RT-PCR detection of FMD viruses and virus serotype The total RNA was extracted from the oral epithelial tissue homogenates using Viral Nucleic Acid Extraction Kit II (Geneaid Biotech Ltd., Taiwan) as per manufacturer‘s instructions. The purity and concentration of extracted viral RNA were measured by using spectophotometry (A260/A280). Extracted RNA was then subjected to uniplex RT-PCR detection of FMDV and multiplex RT-PCR detection of FMDV serotypes (Table 1). The RT-PCR was conducted by using Superscript III one step RT-PCR kit with Platinum Taq (InvitrogenInc, USA). The RT-PCR was carried out in 50μl volume containing of 2× reaction mixture, forward and reverse primers (20pmol in each), Taq polymerase (1μl), RNAse out (1μl), nuclease free water (16μl) and 5μl RNA template (150-200ng viral RNA). A total of 40 cycles of PCR amplification reaction was carried out in a thermocycler (Eppendorf, Germany) using the thermal profile stated in Table 2. The PCR products were electrophoresed in 1.5% agarose gel containing ethidium bromide and the images were captured in a transilluminator (Alpha imager, USA). Sequencing and sequence analysis The cDNAs (VP1, 2A and 2B genes) obtained from multiplex RT-PCR (732bp) were sequenced from 1st Base, Malaysia. The retrieved raw sequence data were first checked for its quality and then edited and assembled with the programmes Chromas Lite, EditSeq and MegAlign. Multiple alignments were done with Clustal W algorithm and Neighbour-Joining phylogenetic tree was constructed with MEGA6 programme. The stability of the nodes in the phylogenetic tree was tested by bootstrapping with 1000 replications. Translational analysis was also carried out using MEGA6 programme to evaluate the level of mutation in genes and for comparison. The sequence information of two isolates was used in translational analysis and phylogenetic analysis. Top RESULTS AND DISCUSSION Clinicopathological investigation During July 2015 several outbreaks of FMD was reported in milk zone areas of Sirajganj District, Bangladesh. Out of 50 cattle investigated in various small scale dairy farms, 17 adult cattle and 05 young calves (below six months of age) were identified as infected. The infected calves (N=04) and adult cattle (N=05) died due to FMD. In this study, common signs observed in infected adult cattle seen were rise in temperature (104°- 105°F), sores and blisters on feet, slobbering and smacking lips, shivering, reduced milk yield. The characteristic changes noted were dry muzzle, lameness, and vesicular eruption on the tongue, muzzle and feet. Five infected adult cattle showed sore mouth and ulcerative legs, they showed inappetence, progressive emaciations and died four to five days after illness. Clinical signs manifested by the infected adult cattle were typical for FMD2,14,18. Four young calves died suddenly in the infected farms showed little lesions in oral and pedal tissues. The visible signs observed were isolation from the flock and marked depression. The infected dead calves and adult cattle were necropsied and gross changes seen were tigroid heart both in young and adult cattle (Fig. 1a). Cardiac degeneration and necrosis commonly refer to as “tiger heart” disease was characterized by irregular gray and pale streaking in the red myocardium5,19,20. The lungs appeared congested and consolidated and showed lobar pneumonia (Fig. 2a). The characteristic ulcerative lesions on feet were seen in adult cattle. The ulcerative lesions in interdigital space red and eroded covered with a gray fibrinous coating and a zone of inflammation. There was pancreatitis, severe pneumonia, and widespread hemorrhages throughout the body. Pasteurella bacteria was commonly isolated from the lungs of infected and dead cattle (data was not shown). The morbidity to mortality in young (below six month of age) and elderly cattle due to FMD were 80% and 29%, respectively. The formalin fixed tissues were stained using H&E and examined under microscope showed necrotic lesions in the heart, lungs, oral and pedal tissues. The dead calves developed vesicular lesions in the skin of interdigital space and epithelial lining of lingual mucosa and tongue muscle. Myocarditis was seen as a fatal form of FMD (Alexandersen and Mowat, 2003) and was characterized by the hyaline degeneration and necrosis of cardiac muscle fibers (Fig. 1a, b, c). There were profuse hemorrhages and infiltration of reactive cells in the necrosed heart muscle14,20,21.As Pasteurella spp. was also isolated from the lungs of infected animals, the bacteria are a commensal in respiratory system of cattle and may also confer fatality in infected animals. Inflammatory lesions were also seen in tongue, interlobular septa and bronchi of lungs (Fig. 2b, c) and pancreas. A definitive link with FMD to pancreatic disorders was not established yet, but endocrine disturbances were suspected by some earlier investigator22. This may contribute a long term effect in cattle following chronic FMD viral infection. There was marked thickening of interlobular septa of lungs, the extent of lung lesions as seen in infected but dead cattle could have contributed respiratory distress (panting at time of plowing) following recovery. Nazneen20 also reported similar respiratory lesions in young and adult cattle infected and died due to FMD. It is not clear, whether, the death of infected cattle as seen was solely for FMD viral infected or due to secondary bacterial (Pasturella spp.) infection, required further study. RT-PCR detection of FMD viruses and viral serotypes Diagnosis of FMD in the field is usually made by observing characteristics clinical signs. Identification of the viruses and its serotypes can be made by isolation of the virus in culture or by the demonstration of FMD viral antigen or nucleic acid in samples of tissue or fluid. FMD is caused by RNA virus and to establish a confirmatory diagnosis, the viral RNA from infected animals may be used in RT-PCR5,14,23. The viral RNA is available in the vesicular fluid, infected epithelial tissue, oesophageal-pharyngeal (OP) fluid, milk, or blood of acutely infected cattle2. In this study, oral mucosa was collected from the infected and dead animals as a source of viral RNA. RT-PCR detection of Lpro gene of FMD virus as designed earlier14 was used successfully with the clinical samples. Out of 10 RNA samples from oral lesions tested, seven samples found to generate 430bp amplicons specific for FMD viruses (Fig. 3a). RNA samples were used in multiplex RT-PCR detection of FMD viral serotypes and generated 732bp amplicons in seven cases, indicating infectivity due to FMD viral serotype A (Fig. 3b). FMD viral RNA was not detected in three cases; this could be due to collection of oral tissues 5–7 days after infection and presence of very low concentration of viral RNA in tissue samples. All of the cattle in the investigating areas were infected with FMD viral serotype “A” and could be an outbreak due to similar virus. Previously, Nazneen20 also investigated similar outbreaks in different Upazilla of Sirajganj district but infectivity due to FMD viral serotype A was not reported. However, the multiplex RT-PCR appeared very useful tool for quick serotyping of FMD viral serotypes. This protocol was originally developed by Vangrysperre and De Clercq17; validated with large number of clinical samples in the Department of Pathology, Faculty of Veterinary Science, Bangladesh Agricultural University. The detection of viral serotypes is highly sensitive and all of the viral serotypes can be identified from field samples in a reaction5,24. Sequencing and sequence analysis FMD viruses are highly mutagenic and genetic characterization is required to select vaccine viruses and designing future preventive strategies25. The genetic diversity among the FMDV serotype A during a period of July 2015 was studied by sequencing three PCR products (732bp) of multiplex RT-PCR containingVPl, 2A and 2B genes. Following sequencing three samples, all positions containing gaps and missing data were eliminated and nucleotide bases were stand in the final dataset and analyzed. Two samples showed 100% identity in VP1 gene and hence, out of three, two samples were chosen for analysis. The VP1 gene of FMD viruses containing 639 bases but following correction and editing 306 bases was stands (sample No. 5 and 9). Among these bases a total of 21–22 point mutations were noted. Translational analysis revealed replacement of 4 amino acids(aa) in position 143, 168, 190 and 196 of the VP1 gene sequenced (Fig. 4). About 25 substitutions of aa were proposed for the FMD viral serotype A and the VP1 gene appeared highly variable. Out of 25 available substitutions sites for the viral serotype A26, highest (N=13) amino acids (aa) substitution was reported in a case BD_AH_09_2012. Habib26 also reported two other isolates (BD_AH_10_2013 and BD_AH_11_2011) where aa substitution was noted in nine and six points respectively. In this study aa substitution was noted in four points and this may be due to fact that short fragment of VP1 gene analyzed. The sequences of 2A and 2B genes (240bp) obtained were also analyzed. Significant mutation in the sequences of 2A and 2B gene of FMD virus was not seen (BD_ Path_A1_2A2B and >BD_ Path_A2_2A2B). The 2A and 2B gene of FMD virus is not serotype specific. The information gathered from the sequence of VP1, 2A and 2B genes of FMD viruses can be used in epidemiological investigation, pathogenesis and probable source of viruses, especially the region of origin and to select suitable vaccine strain(s). The genetic information of 2A and 2B gene will be of little value of studying genetic diversity of FMD viral serotype A. Phylogenetic analysis of VP1 gene The phylogenetic tree constructed using Indian, Asian, African, European and other available sequences downloaded from GenBank, the FMDV serotype A isolates were distributed into 10 major genotypes (designated as I-X). The Bangladeshi and Indian isolates were distributed in 4 genotypes (I, IV, VI and VII), and co-circulation of at least 2 genotypes (VI and VII) in different areas/states of India and Bangladesh in recent decades25,27,28,29. Phylogenetic tree constructed using the gene sequence of FMD viral serotype “A” indicated that the FMD viral serotype “A” circulating in Sirajganj district belonging to genotype VII of the Asian topotype (Fig. 5). The FMD viral Serotype A belonging to the Asian topotype was initially found in India, Bhutan, Srilanka and subsequently spread to other geographic regions including Bangladesh30. The genotype I and VII have the tendency to cross continental barriers suggesting wider distribution compared to genotype III and X, restricting to a particular country29. The FMD virus serotype A (Genotype VII of the Asian topotype) found to cause mortality both in young and adult cattle. In conclusion, the analysis of the VP1 gene sequence of the three isolates revealed that the viruses were originated from a similar pocket. However, the mutations as seen in FMD viral serotype A could have contributed antigenic heterogeneity and increased pathogenicity as the adult cattle were also died. The Lpro and VP1 gene specific RT-PCR protocol adapted in this study was unique to detect FMD viruses and viral serotype respectively. The sequence information may be of value to select future vaccine viruses and evaluating virulence properties of FMDV. Top Figures | Fig. 1.: Examination of heart at necropsy showed tiger heart disease (a, arrow). The histopathological examination, (b and c, 10x) revealed hyalinization of cardiac muscle fibers (b, circle). Calf died following infection showed multifocal necrosis and accumulation of lymphocytes (c, circle) in heart muscle.
|  | |
| | Fig. 2.: Examination of lungs at necropsy (a) and following histopathology (b and c, 10x). At necropsy congested and consolidated lungs (a, white arrow) was seen. Interlobular septa of infected and dead calf showed markedly thickening (b, black arrow) due to deposition of fibrin. Infiltration of mononuclear cells was seen (c, red arrow) in the bronchial wall and interstitium. The bronchiole appeared much dilated (c, red arrow).
|  | |
| | Fig. 3.: RT-PCR detection of FMD viruses (a, 430bp) and FMD viral serotype (b, 732bp). The lane L is for 100bp ladder, NC is for negative control, PC is for positive control and lanes 1 to 10 are for test samples. Out of 10 samples tested in RT-PCR, seven samples appeared to yield 430bp (a) and 732bp (b) amplicons suggestive for infectivity due to FMD viruses and FMD viral serotype A, respectively.
|  | |
| | Fig. 4.: Deduced amino acid comparison with VP1 sequence of Bangladeshi and Indian A isolates. Only four substitutions were found in context with previous Bangladeshi isolates
|  | |
| | Fig. 5.: Phylogenetic tree (N-J tree) constructed using the VP1 gene sequence (306bp) of FMD viral serotype “A” indicated that the FMD viral serotype “A” circulating in Sirajganj district, Bangladesh is belonging to genotype VII of the Asian topotype.
|  | |
|
Tables | Table 1.: Primers used in RT-PCR detection of FMD viruses (Islam et al., 2016) 14 and FMD virus serotypes17.
| | Primer Name | Sequence (5'-3') | Orientation | Amplicon size/genes | Serotype | References | | Primers for uniplex RT-PCR | | FMD F | CTCTCTGTTACACGCTCTCAG | Forward | 430bp/Lpro gene | FMD viruses | Islam et al., 2016 | | FMD R | GAACACAGCGTGTTCTTGCC | Reverse | | Primers for multiplex RT-PCR | | P33 | AGCTTGTACCAGGGTTTGGC | Reverse | | | Vangrysperre | | P38 | GCTGCCTACCTCCTTCAA | Forward | 402/VP1 gene | O | and De Clercq | | P40 | GTTTCTGCACTTGACAACACA | Forward | 596 | C | (1996) | | P74 | GACACCACTCAGGACCGCCG | Forward | 292 | Asia1 | | | P75 | GACACCACCCAGGACCGCCG | Forward | | | | | P76 | GACACCACACAAGACCGCCG | Forward | | | | | P77 | GACACGACTCAGAACCGCCG | Forward | | | | | P110 | GT(G:A:T:C)ATTGACCT(G:A:T:C) | Forward | 732/VP1,2A, 2B | A |
| | | Table 2.: Thermal profile used in RT-PCR amplification of various genes of FMD viruses.
| | Primer name | Reverse Transcription | Initial denaturation | Denaturation | PCR (40 cycles) Annealing | Elongation | Final elongation | Hold at | | FMD F | 45°C for | 94°C for | 94°C for | 55°C for | 72°C for | 72°C for | 4°C | | FMD R | 45 mins | 5 mins | 60 secs | 60 secs | 2 mins | 7 mins | | P33, P38, | 50°C for | 95°C for | 95°C for | 55°C for | 72°C for | 72°C for | 4°C | | P40, P74, P75, P76, P77, P110 | 30 mins | 5 mins | 60 secs | 60 secs | 2 mins | 7 mins |
| |
|